Manuscript accepted on : 01-09-2020
Published online on: 09-09-2020
Plagiarism Check: Yes
Reviewed by: Prabin Shrestha
Second Review by: Mohamed Gamal Shehata
Final Approval by: Dr. Saiful Irwan Zubairi
Paroma Arefin1*, Ruhul Amin2
, Md. Zafar As Sadiq1, Subarna Sandhani Dey1, Farhana Boby1, Md.Shimul Parvaz1, Murshed Hasan Sarkar1
, Md. Shehan Habib3
, AKM Shamsul Alam1 and Md. Ibrahim1
1Fruits and Food Processing and Preservation Research Division,Bangladesh Council of Scientific and Industrial Research Laboratories, Binodpur Bazar, Rajshahi, Bangladesh
2Bangladesh Council for Scientific and Industrial Research (BCSIR), Dhaka, Bangladesh
3Bangladesh Council for Scientific and Industrial Research (BCSIR), Chattogram, Bangladesh
Corresponding Author E-mail : paroma.arefin@gmail.com
DOI : http://dx.doi.org/10.13005/bbra/2849
ABSTRACT: Tomato is a popular vegetable throughout the whole world. Use of harmful preservatives or high amount of preservatives can deteriorate the quality of food and cause harm. In this paper, we have studied the effect of naturalnatural coatings i.e. mixtures of Aloevera gel, pectin and olive oil on the quality parameters and extension of shelf life of different tomato (Local, Bizli and Lovely) cultivars.TomloxC is a gene that increases in amount when the tomato ripens. We studied the expression of TomloxC gene and measured physical parameters and nutritional values of the coated and uncoated tomatoes.The expression of this gene is less in coated tomatoes than in uncoated tomatoes which indicated the efficiency of the coating. The physical parameters and nutritional characteristics were also found better in the coated ones. The shelf life of coated fruits increased to 4 to 6 days compared to that of uncoated ones. The average weight loss was 5-7% less in coated tomatoes than in uncoated one. So, the combined mixture of natural coating of Aloevera gel, pectin and olive oil has high prospects to be used as a coating for vegetables.
KEYWORDS: Aloe vera coating; Gene Expression; Nutritional value; Pectin; Physical parameters; Tomato; TomloxC
Download this article as:![icon_pdf](https://biotech-asia.org/wp-content/uploads/2016/05/icon_pdf.png)
Copy the following to cite this article: Arefin P, Amin R, Sadiq M. Z. A, Dey S. S, Boby F, Parvaz Md. S, Sarkar M. H, Habib M. S, Alam A. K. M. S, Ibrahim M. A Study of Effectiveness of Natural Coatings on the Shelf Life Extension of Tomatoes by the Observation of TomloxC Gene Expression. Biosci Biotech Res Asia 2020;17(3). |
Copy the following to cite this URL: Arefin P, Amin R, Sadiq M. Z. A, Dey S. S, Boby F, Parvaz Md. S, Sarkar M. H, Habib M. S, Alam A. K. M. S, Ibrahim M. A Study of Effectiveness of Natural Coatings on the Shelf Life Extension of Tomatoes by the Observation of TomloxC Gene Expression. Biosci Biotech Res Asia 2020;17(3). Available from: https://bit.ly/2RaWns7 |
Introduction
Tomato is very popular and widely consumed throughout the world. It can be eaten raw and cooked. They are used to prepare soup, juice ketchup, pickle, pasta and powder. Tomato is also popular because it is a promising source of vitamin C and adds variety of colors and flavors to the food.1 Dried tomato juice is rich in vitamin C. It is also considered to be intestinal antiseptic,anti-diabetic and also reduced heart disease. Depending on age groups, the requirement for vitamin C and vitamin A is about 30-40 mg/ 100mg and 2500-3000 mg /100mg thus daily consumption of 100g tomato, the requirement of vitamin C and vitamin A respectively will be met up. The perish ability of tomato is very high i.e. shelf life is very short. Soextension of shelf life of tomato is required.
The shelf life of any fruit consists of ripening and senescence.2 After harvest, fruits undergo many physiological and biochemical changes. The shelf life of fruits could be prolonged significantly through slowing down the process leading to ripening and controlling the microbial decay.3-6 Information regarding the extension of storage life of tomato through the treatment of natural coatings in Bangladesh is very scanty. Artificial preservatives and chemicals are often very injurious to health in the long term. The present study has been undertaken to extend the storage life (Shelf life) and to reduce the spoilage of tomato caused by various factors without changing its quality. In this study, the aim is to observe the effect of natural coating of aloe vera, olive oil and pectin on delaying ripening of tomatoes and increasing the shelf life. Aloe vera has given good results in increasing shelf life of fruits previously.7-10
The ripening of fruits is influenced by auxins, ethylene, brassinosteroids and SBA. In climacteric fruits, including tomato, avocado, peach and apple, ripening is marked by a respiratory burst linked to the production of ethylene.11,12
There are five lipoxygenases (TomloxA, TomloxB,TomloxC, TomloxD, and TomloxE) available in tomatoes Lycopersicon esculentum). Lipoxygenases play vital role in disrupting chloroplast thylakoid membranes. This is required for thetransformation from chloroplast to chromoplastduring fruit ripening. The substrate for LOX is usually believed to be unesterified polyunsaturated fatty acids produced from complex lipids through the action of lipases. 13Chloroplasts have been suggested as the main site for hydroperoxide synthesis of fatty acids. Interruption of these thylakoid membranes may result in linoleic and linolenic acids. TomloxC is a primary lipoxygenase that primarily engages in the generation of short-chain flavor compounds derived from fatty acids C6 and is essential in the generation of fruit flavor and ripening properties.14 Experiments on the regulation of gene expression related to fruit shelf life and ripening is necessary to prove the efficiency of the preservatives by providing real time PCR data. TomloxC is a chloroplast-targeted lipoxygenase that is generated at significant concentrations during fruit maturation, and so it is clearly a worthy target.14,15
Preservation of food, fruits and vegetables in a natural way is explored for a long time. The goal of this research is to evaluate the natural coatings efficiency in extension of shelf life of tomato and analysis of related gene expression by real time PCR.16,17
Materials and Methods
Freshly harvested Aloe vera leaves were collected from the local market for processing and preparation of Aloe vera gel finally used as natural coatings. The leaves should be sound, undamaged, mold/ rot free and matured in order to keep all the active ingredients in full concentration. The leaves were washed with water and removed unexpected organ and peeled. The pulp were collected and homogenized by blending and mixed and the mixture was filtered then it was heated at low temperature for two hours. Now the aloe vera gel was cooled and added to 3% pectin powder and 5% olive oil mixed with over head stirrer in 3000 rpm for two hours. Then the homogenized mixture was cooled and ready for use as natural coatings.17,18 Experimental samples were taken from sound ripe and disease free tomato (Local, bizli and lovely cultivars) from local market of Rajshahi and washed with distilled water and air dried.
Tomatoes were placed in 20 L container containing natural coatings for 10 min and exposed to different treatments. Control uncoated) fruits were maintained in identical condition without treatment at ambient temperature. Tomatoes were air dried and stored for observation at an ambient temperature (28-30ºC) and relative humidity (70-72%). For each parameter, three sets of independent experiments were carried out and fifteen Tomatoes were employed for each set of experiment and analytical work. Starting with day 0 immediately after treatment) till day last edible stage (15 days), one tomato from each of the coated and uncoated were taken, analysis were performed. The experimental samples were taken from the uncoated and coated samples to analyze physical and chemical characteristics at two days intervals.
The sugar content was determined by spectrophotometrically by the Lane and Eynon method,19 and the reducing sugar was estimated by the DNSA method using 3, 5-Dinitrosalicylic acid (DNSA).20 Vitamin C was also estimated by spectrophotometric method. 5 ml of 1gm/ml sample was prepared and centrifuged at 5000 rpm. Then 0.5 ml extract was taken and 0.8 ml 10% Trichloroacetic acid was added to it and freezed for 5 minutes. Then it was centrifuged again. The supernatant was taken. 3 ml dH20 and 0.4 ml 10% Folin Ciocalteu’s Reagent ( FCR) solution was added. Then the absorbance was measured at 760 nm.21
TSS was determined by refractometric method and pH was determined by a standard pH meter. Acidity was estimated by acid–base titrimetric method using standard sodium hydroxide solution.23 The preserved tomato was analyzed periodically and the results were recorded in tables (Table 1 and 2).
The related gene expression of the uncoated and coated samples was done at the last edible stage; RNA was isolated from ripe tomato pulp tissue using Promega RNA isolation kit as per instructions provided therein. After RNA extraction, quantification of RNA concentration was done by a micro spectrophotometer K2800 nucleic acid analyzer, Beijing Kaiao Technology Development Co. Ltd; (China). Sample purity was evaluated by calculating absorbance ratio (A230:A280). The extracted RNA of the samples were equalized to 50 ng/ ul to be used as template in reverse transcription PCR and then for real time PCR reaction by diluting with calculated volume of DNAse / RNAse free H2O Amresco,(USA).25,26
For amplification of tomato lipoxygenase(TomloxC), Forward primer: CACATTGGAGATAAATGCCTTAGC and reverse primer: CAGTTGTTGGCCTATTTGGAAAG were used (GenBank accession number: U37839).26
TomloxC amount was measured by RT-PCR in coated and uncoated tomatoes. The following cycling protocols were used : 95ºC for 5 minutes , followed by 30 cycles of 95ºC for 15 sec, 60 ºC for 30 sec per cycle and 72ºC for 15 sec with a final extension of 72 ºC for 10 min. Melt curve analysis is done by instrument’s default parameters. Real–Time PCR analysis was carried out in a Rotor Gene Q (QIAGEN) with 20 µl reaction volume consisting of 4ul of master mix, 2.5 µl of primer and probe mix, 11 µl of ddH2O and 2.5 µl of DNA template containing 125 ng of total DNA. Required dilution was performed using DNAse/ RNAse free water.27
Results and Discussions
The natural coatings applied for the extension of shelf life of tomato cultivars extended the shelf life 4 to 6 days compared to uncoated one as shown in Figure 1 and Figure 2. The weight loss of the coated tomato was affected (Figure 3) showed that the weight loss in coated tomato was significantly lower than that of uncoated Tomatoes. So, the natural coating was also found to have beneficial effects on firmness retention and delaying fruit softening.
![]() |
Figure 2: Average shelf life of coated and uncoated tomato cultivars |
![]() |
Figure 3: Average weight loss (%) of coated and uncoated tomato cultivars |
Table 1 and 2 showed the nutritional quality of tomato that was also affected remarkably after the treatment with natural coatings at the last edible stage.
Tomatoes from the coating treated Coated) might have superior quality as the protein, B carotene, vitamin C, total sugar, reducing sugar, non reducing sugar, total soluble solids, carbohydrate, phosphorus etc content of its pulp were higher than those of uncoated Tomatoes. The amount of moisture, Total sugar, Reducing sugar, non reducing ,carbohydrate, phosphorus, vitamin C ,protein, B-carotene were higher while the amount of dry matter, ash, pH were lower as compared to the amount of those present in the pulp of uncoated tomato. Application of edible natural coatings on preservation of tomato resulted in extended shelf life, reduced average weight loss, and acceptable improvement in sensory characteristics.
Table 1: The Physical parameters of tomato pulp from uncoated and coated ripe sample tomatoes at the last edible stage during the storage period.
Name of tomato cultivars | Treatment | Juice % | TSS % | pH | Dry mater % | Moisture % | Ash % | Acidity % as citric acid |
Local | Coated
uncoated |
77.0
74.5 |
6.5
6.0 |
4.48
4.59 |
4.79
5.53 |
95.21
94.47 |
0.46
0.51 |
0.095
0.072 |
Bizli | Coated
uncoated |
75.0
72.5 |
6.5
6.0 |
4.47
4.53 |
5.03
5.04 |
94.97
94.96 |
0.34
0.50 |
0.103
0.043 |
Lovely.
|
Coated
uncoated |
70.0
75.0 |
7.0
6.5 |
4.02
4.22 |
6.09
6.40 |
93.91
93.60 |
0.52
0.55 |
0.163
0.127 |
Table 2: The nutritional value of tomato pulp from uncoated and coated ripe tomato at the last edible stage during the storage period
Name of tomato cultivars |
Treatments | Total sugar % | Reducing sugar % | Non reducing sugar % | Protein % | B- carotene mg/100g | Phosphorous % | Vitamin C mg/ 100g | Carbohydrate % |
Local | Coated
uncoated |
3.63
3.47 |
1.38
1.33 |
2.25
2.14 |
0.62
0.49 |
341
273 |
26.03
23.60 |
10.87
09.33 |
4.76 4.53 |
Bizli |
Coated
uncoated |
4.38
3.95 |
1.42
1.26 |
2.96
2.69 |
0.58
0.51 |
380
326 |
19.35
18.09 |
13.60
18.43 |
5.42
4.91 |
Lovely | Coated
uncoated |
5.03
4.86 |
1.86
1.78 |
3.17
3.08 |
0.63
0.46 |
351
302 |
21.85
19.72 |
9.70
6.96 |
6.23 5.84 |
Figure 4 indicates that the expression of TomloxC is less in treated tomatoes as compared to the control ones. So, it can be said that the coating has vital role in delaying ripening.
![]() |
Figure 4: Comparative Analysis of Melting Curve for TomloxC gene of Coated (Aloe vera coating Treatment) and Uncoated (Control) tomatoes |
The Melt curve shows that the value of change in fluorescence level with respect to per unit change in temperature (dF/dT) is greater in uncoated tomatoes (3.4) in comparison to coated tomatoes(1.6). It means that the coated tomatoes contained less amount of amplified TomloxC gene in comparison to coated ones. Previous studies show that TomloxC gene is expressed in higher amount in riper tomatoes. So, the findings indicate that the aloe vera gel coating has delayed the ripening of tomatoes.28
The shelf life of coated fruits increased to 4 to 6 days compared to that of uncoated ones. The average weight loss was 5-7% less in coated tomatoes than in uncoated one. So, it can be concluded that application of the pectin–based coating on tomatoes was effective in reducing the associated physiological changes and extending the storage life.
Conclusion
Now a day, various toxic chemicals are often used to preserve fruits and vegetables or extend the shelf-life. Findings from the current work are effective for solving this issue. Usage of edible natural coatings on tomato resulted in increased shelf life, decreased average weight loss and reasonable sensory enhancement. Thus, it can be concluded that the application of aloe vera based natural coating has great potential in reducing the ripening-related physiological changes and prolonging the shelf life of tomatoes and other fruits and vegetables. The natural coatings might be used to eradicate the use of hazardous chemicals in order to conserve the nation and climate.
Acknowledgements
Dr Md Ibrahim, Paroma Arefin and Ruhul Amin has designed the research. Zafar As Sadiq, A K M Shamsul Alam, Subarna Sandhani Dey, Farhana Boby and Md Shimul Parvaz have been involved in laboratory experiments. Paroma Arefin, Md Murshed Hasan Sarkar, and Md Shehan Habib have contributed to writing the paper.
Conflict of Interest
This research has no conflict of interest.
Funding Source
There is no funding source
References
- Manzano- Mendez J, Hicks JR and Masters, JF 1984. Influence of storage temperature and ethylene on firmness, acid and sugars of chilling–sensitive and chilling–tolerant tomato. J. Am. Soc. Hortic. Sci. 109: 273-277.
- Dang KTH, Singh Z and SwinnyEE Edible coatings influence fruit repining quality and aroma biosynthesis in mango fruit. J. Agric. Food Chem. 56: 1361-1370.
- Fabian G, Huertas M, Diaz- Mula, PJ, Zapata, Daniel V, Maria S, Salvador C and Domingo MR 2013. Aloe araborescens and Aloe vera gels as coating in delaying postharvest ripening in prach and plum fruit. Postharvest Biol and Technol. 83: 54-57
- Vahdat S, Ghazvoni RF and Ghasemnezhad M 2010. Effect of Aloe vera gel on maintenance of strawberry fruits quality. Acta Hort. 877: 919-924.
- Valverde JM, Valero D, Martinez-Romero D, Guillel F, Castillo S, Serrano M2005. Nobel coating based on Aloe vera gel to maintain table grape quality. Agric. Food Chem. 53: 7807-7813.
- Benitez S,Achaerandio I, Sepulcre F, and Pujola M 2013. Aloe vera based edible coating improve the quality of minimally processed Hayward Kiewifruit. Postharvest Biol and Technol. 81:29-36.
- Chandegara VK and Varshney AK 2014. Effect of centrifuge speed on gel extraction from Aloe vera leaves. Food Process Technol.51:1-6.
- Singh DBR, Singh ARP, Kihgly Sharma RR 2011. Effect of Aloe vera coating on fruit quality and storability Fragaria x Annassa). Indian J. Agr. Sci. 81: 407-412.
- Singh RN, Sing G, Mishra JS, Rao OP and Sing G1987. Studies on the effect of pre and postharvest treaments of calcium nitrate and calcium chloride in the storage life of amropali mango. Prog Hort. 19(1-2): 1-9.
- Singh S, Kushwaha BP, Nag SK, Mishra AK, Bhattacharya S, Gupta PK, Singh A 2011. In vitro methane emission from Indian dry roughages in relation to chemical composition. Current Science, 101(1): 57-65.
- Adams-Phillips L, Barry C, Kannan P, Leclercq J, Bouzayen M and Giovannoni J 2004. Evidence that CTR1-mediated ethylene signal transduction in tomato is encoded by a multigene family whose members display distinct regulatory features. Plant MolBiol 54:387-404.
- Chattopadhyay N, Hore JK andSen SK. 1992. Extension of storage life of sweet orange Citrus sinensisOsbeek) CV Jaffa. Indian J. of Plant Physiology. 35 (93): 245-251.
- Alexander L and Grierson D 2002. Ethylene biosynthesis and action in tomato: a model for climacteric fruit ripening, J of Exp Bot, 531: 2039–2055, https://doi.org/10.1093/jxb/erf072.
- Chen G, Hackett R, Walker D, Taylor A, Lin Z, and Grierson D 2004. Identification of a specific isoform of tomato lipoxygenase TomloxC involved in the generation of fatty acid-derived flavor compounds. Plant physiology, 136 2641–2651. https://doi.org/10.1104/pp.104.041608
- Wang L, Baldwin EA & Bai J 2016. Recent Advance in Aromatic Volatile Research in Tomato Fruit: The Metabolisms and Regulations. Food Bioprocess Technol 9: 203–216 https://doi.org/10.1007/s11947-015-1638-1.
- Hu T & Qv X & Hu Z & Chen, G & Chen, Z 2011. Expression, molecular characterization and detection of lipoxygenase activity of tomloxD from tomato. African Journal of Biotech. 10. 490-498.
- Mariutto M, Duby F, Adam A, Bureau C, Fauconnier ML, Ongena M, Thonart P, Dommes J 2011. The elicitation of a systemic resistance by Pseudomonas putida BTP1 in tomato involves the stimulation of two lipoxygenase isoforms. BMC Plant Biol, 11:29. doi: 10.1186/1471-2229-11-29.
- Changhong HE, Kojo E and Tian Z 2005. Quality and Safety assurance in the processing of aloe vera juice. Food Control.162: 95-104
- Method 923.09: invert sugar in sugars and syrups, lane eynon general volumetric method, final action. 1990. Official Methods of Analysis of Association of Official Analytical Chemists, Better World Books, Reno, NV, USA, 15th edition
- Miller GL 1959. Use of dinitrosalicylic acid reagent for determination of reducing sugar. Chem. 31(3): 426-428
- Rodger A and Sanders K 2017. UV-Visible Absorption Spectroscopy, Biomacromolecular Applications. Encyclopedia of Spectroscopy and Spectrometry (Third Edition)
- Arefin P, Sakib T, Habib MS, Saha T, Boby F. 2019. Evaluation of pH of Facial Cleansers Available in the Bangladeshi Market. Nov App in Drug Des & Dev; 5(2): 39-41. doi:10.19080/ NAPDD.2019.05.555660.
- Jayaraman, J. Laboratories Mannual in Biochemistry 1981. New age Internatinal Lit, 180.
- Yang XY, Jiang WJ, Yu HJ. The expression profiling of the lipoxygenase (LOX) family genes during fruit development, abiotic stress and hormonal treatments in cucumber (Cucumis sativus L.). Int J Mol Sci. 2012;13(2):481-500. doi: 10.3390/ijms13022481.
- Marone M, Mozzetti S, De Ritis D, Pierelli L and Scambia G 2001. Semiquantitative RT-PCR analysis to assess the expression levels of multiple transcripts from the same sample. Biol Proced Online.3:19-25. doi: 10.1251/bpo20.
- https://www.ncbi.nlm.nih.gov/genbank/
- Romero Mdel M, Grasa Mdel M, Esteve M, Fernández-López JA, Alemany M. 2007.Semiquantitative RT-PCR measurement of gene expression in rat tissues including a correction for varying cell size and number. Nutr Metab (Lond).4:26. doi: 10.1186/1743-7075-4-26.
- Arefin P, Amin R, Sadiq M Z, Dey S S, Boby F, Sarkar MMH, Habib MS, Alam AKMS , Parvaz MS, Ibrahim 2020. Extension of Shelf Life of Mango by Aloe Vera based Coatings and Related Gene Expression by Real Time Polymerase Chain Reaction. Bang Journ of Nutr.(Accepted)
This work is licensed under a Creative Commons Attribution 4.0 International License.